View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710_high_24 (Length: 263)
Name: NF2710_high_24
Description: NF2710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710_high_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 252
Target Start/End: Complemental strand, 33650100 - 33649868
Alignment:
| Q |
19 |
tcaggcttggatgagatgggtcagagaatgcaaggagctttgaagacaatggaagatgcaattagagcttaaaattgaagtagtcattgttagacccacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33650100 |
tcaggcttggatgagatgggtcagagaatgcaaggagctttgaagacaatggaagatgcaattagagcttaaaattgaagtagtcattgttagacccacc |
33650001 |
T |
 |
| Q |
119 |
aagatatgaaatttaaccgttggatcaaaatcggacgctaacgattttaaactcggtattttagnnnnnnnnnnnctttaaataatcaaatcatgtattg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33650000 |
aagatatgaaatttaaccgttggatcaaaatcggacgctaacgattttaaactcggtattttag-ttttttttttctttaaataatcaaatcatgtattg |
33649902 |
T |
 |
| Q |
219 |
aaatttggatctatcaatctcatatccaaatatt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33649901 |
aaatttggatctatcaatctcatatccaaatatt |
33649868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 22 - 99
Target Start/End: Complemental strand, 33634949 - 33634872
Alignment:
| Q |
22 |
ggcttggatgagatgggtcagagaatgcaaggagctttgaagacaatggaagatgcaattagagcttaaaattgaagt |
99 |
Q |
| |
|
|||||||||| ||||||| ||||||| |||| |||||| ||||| |||||||||||| || |||| |||||||||||| |
|
|
| T |
33634949 |
ggcttggatgtgatgggtaagagaattcaagaagctttcaagaccatggaagatgcacttggagcctaaaattgaagt |
33634872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University