View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710_high_25 (Length: 251)
Name: NF2710_high_25
Description: NF2710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 56 - 234
Target Start/End: Complemental strand, 32672378 - 32672200
Alignment:
| Q |
56 |
atagccaaccgaggtttaaggctgtggagaaagccaatagcagtcaatgttaaatgtaatgtggacacgactatttttaaggaacaatgttggtgcagta |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |||||| ||||| |
|
|
| T |
32672378 |
atagccaaccgaggtttaaggctgtggagaaagccaatagcagccaatgttaaatgtaatgtggacgcgactatttttaaggaacaaggttggtacagta |
32672279 |
T |
 |
| Q |
156 |
tgggaatgtgtctatgaggggaaaacggagaaaatttgcggcaaaagcagcatggtttaagggccttctacaggtttat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
32672278 |
tgggaatgtgtctatgaggggaaaacggagaaaatttgcggcaaaaacagcatggtttaagggccctctacaggtttat |
32672200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 32672465 - 32672410
Alignment:
| Q |
1 |
taggtatgtgaagttcatctgttacaatggcagcagttccgggaca-caagtctcg |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32672465 |
taggtatgtgaagttcatctgttacaatggcagcagttccgggacagcaagtctcg |
32672410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University