View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710_low_31 (Length: 235)
Name: NF2710_low_31
Description: NF2710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 16240177 - 16239975
Alignment:
| Q |
18 |
ctttctacaataacctttacaatccatcgtagaacaactacccacaatttttgcacatgtagctcccaccagtattgattgcactgtgctcccaatcaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16240177 |
ctttctacaataacctttacaatccatcgtagcacaactacccacaatttttgcacatgtagctcccaccagtattgattgcactgtactcccaatcaaa |
16240078 |
T |
 |
| Q |
118 |
ttggggaagaaatattagtgagttttcgatccaacaaccacggatatgctaatcggatctagcaagaccaggattgcttgcagtcaaaagtttgccaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
16240077 |
ttggggaagaaatattagtgagttttcgatccaacaaccacggatatgctaatcggatctagcaagaccaggattgcttgcagtcaaaagtttgccgatt |
16239978 |
T |
 |
| Q |
218 |
cat |
220 |
Q |
| |
|
||| |
|
|
| T |
16239977 |
cat |
16239975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 111
Target Start/End: Complemental strand, 16264805 - 16264727
Alignment:
| Q |
33 |
tttacaatccatcgtagaacaactacccacaatttttgcacatgtagctcccaccagtattgattgcactgtgctccca |
111 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||| ||| ||||||||| | || ||||||||||||||| | |||||| |
|
|
| T |
16264805 |
tttacaatccatcacagaacagctaccaacaattcttgggcatgtagcttctactagtattgattgcactatactccca |
16264727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University