View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2710_low_33 (Length: 204)
Name: NF2710_low_33
Description: NF2710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2710_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 4670100 - 4669921
Alignment:
| Q |
19 |
atggtcggtaaattagagcttccaaaccaaaatcatccatatctatgcaaattacaatgacttaacaaagttagtgaagtg---------aaatgttctc |
109 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
4670100 |
atggtcgataaattagagcttccaaaccaaaatcatccatatctatgcaaattacaatgacttaacaaagttagtgaagtgaaagtcactaaatgttgtc |
4670001 |
T |
 |
| Q |
110 |
tagtgagcttttcgactggtccaaaatatcaagatgcatat-gatgccattcctatctatgcatgacaccttgtactttg |
188 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4670000 |
tagtgagcttttcgactagtccaaaatatcaagatacatatggatgccattcctatcgatgcatgacaccttgtactttg |
4669921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University