View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2711_high_39 (Length: 236)
Name: NF2711_high_39
Description: NF2711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2711_high_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 17915443 - 17915359
Alignment:
| Q |
1 |
ccttttaaataattttacgaatcttctaaaaataaattcaaggaaacccgagcaaa-attatttcacattatgaccctttcttcct |
85 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||| ||||||| ||||||| |||||||| ||||||||||| |
|
|
| T |
17915443 |
ccttttaaataattttacaaatcttttaaaaataaattcaaggaaacctgagcaaacattattttgcattatga-cctttcttcct |
17915359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University