View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2711_high_44 (Length: 207)
Name: NF2711_high_44
Description: NF2711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2711_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 1404785 - 1404610
Alignment:
| Q |
16 |
aaggataccttaaaatctttactagggtaaagaccttaattcttacggtgaggaaaataacccagacaaggatttgacgttaactaataattatcttcca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
1404785 |
aaggataccttaaaatctttactagggtaaagaccttaattcttacggtgaggaaaataacccagacaaggatttgacgttgactaatagctatcttcca |
1404686 |
T |
 |
| Q |
116 |
gcatatgtacaaactttcatgattcatacaatatnnnnnnntttcttttaaagttacgaaattgataaatggagggt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
1404685 |
gcatatgtacaaactttcatgattcatacaatataaaaaaatttcttttagagttac-aaattgataaatggagggt |
1404610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University