View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2711_low_39 (Length: 241)

Name: NF2711_low_39
Description: NF2711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2711_low_39
NF2711_low_39
[»] chr1 (1 HSPs)
chr1 (1-223)||(45592597-45592819)


Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 45592597 - 45592819
Alignment:
1 tcttcagatgctgtgcttacaagagttgcaacagaaaagaggctgtcactaatcaaagcatgggaagaaagtgaaaagtcaaaagcagagaacaagtaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45592597 tcttcagatgctgtgcttacaagagttgcaacagaaaagaggctgtcactaatcaaagcatgggaagaaagtgaaaagtcaaaagcagagaacaagtaag 45592696  T
101 agctttcaccatctaatgtttaattttcaaatttttagaaccttattacatcgagtcatgaatttgatgagcagagctcagagaagactttcaaccataa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45592697 agctttcaccatctaatgtttaattttcaaatttttagaaccttattacatcgagtcatgaatttgatgagcagagctcagagaagactttcaaccataa 45592796  T
201 cagcatgggagaacagtaagaaa 223  Q
    |||||||||||||||||||||||    
45592797 cagcatgggagaacagtaagaaa 45592819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University