View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2711_low_40 (Length: 240)

Name: NF2711_low_40
Description: NF2711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2711_low_40
NF2711_low_40
[»] chr2 (1 HSPs)
chr2 (17-146)||(4445938-4446067)


Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 17 - 146
Target Start/End: Original strand, 4445938 - 4446067
Alignment:
17 acttttgctgattaatttttggacggagggaatacatatttgatctctttttcttcacatcggttatgacctctcaaacgtaacacattttttccttaga 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
4445938 acttttgctgattaatttttggacggagggaatacatatttgatctctttttcttcacatcggttatgacctctcaaatgtaacacattttttccttaga 4446037  T
117 aagttgtaaggcgagtgttaatgtgtgtac 146  Q
    ||||||||||||||||||||||||||||||    
4446038 aagttgtaaggcgagtgttaatgtgtgtac 4446067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University