View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2711_low_40 (Length: 240)
Name: NF2711_low_40
Description: NF2711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2711_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 17 - 146
Target Start/End: Original strand, 4445938 - 4446067
Alignment:
| Q |
17 |
acttttgctgattaatttttggacggagggaatacatatttgatctctttttcttcacatcggttatgacctctcaaacgtaacacattttttccttaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4445938 |
acttttgctgattaatttttggacggagggaatacatatttgatctctttttcttcacatcggttatgacctctcaaatgtaacacattttttccttaga |
4446037 |
T |
 |
| Q |
117 |
aagttgtaaggcgagtgttaatgtgtgtac |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4446038 |
aagttgtaaggcgagtgttaatgtgtgtac |
4446067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University