View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2711_low_47 (Length: 207)

Name: NF2711_low_47
Description: NF2711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2711_low_47
NF2711_low_47
[»] chr1 (1 HSPs)
chr1 (16-192)||(1404610-1404785)


Alignment Details
Target: chr1 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 1404785 - 1404610
Alignment:
16 aaggataccttaaaatctttactagggtaaagaccttaattcttacggtgaggaaaataacccagacaaggatttgacgttaactaataattatcttcca 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||  |||||||||    
1404785 aaggataccttaaaatctttactagggtaaagaccttaattcttacggtgaggaaaataacccagacaaggatttgacgttgactaatagctatcttcca 1404686  T
116 gcatatgtacaaactttcatgattcatacaatatnnnnnnntttcttttaaagttacgaaattgataaatggagggt 192  Q
    ||||||||||||||||||||||||||||||||||       ||||||||| |||||| |||||||||||||||||||    
1404685 gcatatgtacaaactttcatgattcatacaatataaaaaaatttcttttagagttac-aaattgataaatggagggt 1404610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University