View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2714_low_6 (Length: 222)
Name: NF2714_low_6
Description: NF2714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2714_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 115 - 203
Target Start/End: Original strand, 1427568 - 1427656
Alignment:
| Q |
115 |
cctagtttgttaatcacagtaaaccatacaccaacaattgagttttggaatgtttttgacatatgaaattttgtttaactttgctataa |
203 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1427568 |
cctaatttgttaatcacagtaaaccatacaccaacaattgagttttgaaatgtttttgatatatgaaattttgtttaactttgctataa |
1427656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 183
Target Start/End: Complemental strand, 2815778 - 2815719
Alignment:
| Q |
124 |
ttaatcacagtaaaccatacaccaacaattgagttttggaatgtttttgacatatgaaat |
183 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||| || ||||||||| |||||||| |
|
|
| T |
2815778 |
ttaatcacagtaaagcatacaccaatttttgagttttgtaaagtttttgacttatgaaat |
2815719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University