View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2715_high_17 (Length: 353)
Name: NF2715_high_17
Description: NF2715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2715_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 17 - 332
Target Start/End: Complemental strand, 41809939 - 41809623
Alignment:
| Q |
17 |
cataggatctctacatcttatttgatcgatgggttcaaattaccaatacatttatgaactatacttacccatgtctatccatttctatctaagctaatac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41809939 |
cataggatctctacatcttatttgatcgatgggttcaaattaccaatacatctatgaactatacctacccatgtctatccatttctatctaagctaatac |
41809840 |
T |
 |
| Q |
117 |
atatttgaatacccagactcgaaacaaacaaatatagaccatggatcttgcaatattttttaccagtgatgttatatggaagcaagttgttgggatctta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41809839 |
atatttgaatacccagactcgaaacaaacaaatatagaccatggatcttgcaatattttttaccagtgatgttatatggaagcaagttgttgggatctta |
41809740 |
T |
 |
| Q |
217 |
ggatcgattaaggttttggttcgttaatttccattgtc-tttgcactattcatgtgtatatgtaatgtgttattcgctttcatatttactaggattgacc |
315 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41809739 |
ggatcgattaaggttttggtttgttaatttccattgtcttttgcactattcatgtgtatatgtaatgtgttattccctttcatatttactaggattgacc |
41809640 |
T |
 |
| Q |
316 |
ttaacatatggaaggag |
332 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
41809639 |
ttaaaatatggaaggag |
41809623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University