View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2715_high_29 (Length: 229)
Name: NF2715_high_29
Description: NF2715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2715_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 213
Target Start/End: Original strand, 47462057 - 47462251
Alignment:
| Q |
19 |
gtgagttcgggtaagacccacaagttgacgggtgtagaccatggtatgagttatcatacactgcatttgatatactattacaaaaatgaagaaaaatggt |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47462057 |
gtgagttcgggtaagagccacaagttgacgggtgtagaccatggtatgagttatcatacactgcatttgatatactattacaaaaatgaagaaaaatggt |
47462156 |
T |
|
| Q |
119 |
ttggatcatttgagttggacccgttgagagaatcattgtctgaagtattgtcgatatatccgacaataacggggcggttgggccgagagaaggag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47462157 |
ttggatcatttgagttggacccgttgagagaatcattgtctgaagtattgtcgatatatccgacaataacgggccggttgggccgagagaaggag |
47462251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University