View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2715_low_14 (Length: 472)
Name: NF2715_low_14
Description: NF2715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2715_low_14 |
 | |
|
| [»] scaffold0200 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 7e-50; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 19 - 163
Target Start/End: Complemental strand, 41818208 - 41818064
Alignment:
| Q |
19 |
gtaacttcattgcagggaaaagcacaaacttttattgctggggcaaattcaatatctgatttactatcaccaatttttatgagtcttttgactggtgagt |
118 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| | ||||| |||||| |
|
|
| T |
41818208 |
gtaacttcattgtaggggaaagcacaaacttttattgctggggcaaattcaatatctggtttactatcaccaattgttatgagtcctctgacttgtgagt |
41818109 |
T |
|
| Q |
119 |
gtaataccaaagctaacttctgattagaccattttacattaattt |
163 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
41818108 |
agaataccaatgctaacttctcattagaccattttacattaattt |
41818064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 19 - 163
Target Start/End: Complemental strand, 41824521 - 41824377
Alignment:
| Q |
19 |
gtaacttcattgcagggaaaagcacaaacttttattgctggggcaaattcaatatctgatttactatcaccaatttttatgagtcttttgactggtgagt |
118 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||| | ||||| | ||||||| |||||| |
|
|
| T |
41824521 |
gtaacttaactgcagggaaaagcacaaacttttattgctggggcacaatctatatctgatttactatcaccaattgtaatgagccctttgacttgtgagt |
41824422 |
T |
|
| Q |
119 |
gtaataccaaagctaacttctgattagaccattttacattaattt |
163 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
41824421 |
agaatactaaagctaacttctcattagaccattttacataaattt |
41824377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 370 - 407
Target Start/End: Complemental strand, 38752644 - 38752607
Alignment:
| Q |
370 |
tctttaatttgtttcagctgcaaaataaggaggctgaa |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38752644 |
tctttaatttgtttcagctgcaaaataaggaggttgaa |
38752607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 406 - 453
Target Start/End: Original strand, 1884484 - 1884531
Alignment:
| Q |
406 |
aataatgatatgaaagatacaagttctagcaggaatcaactagttcct |
453 |
Q |
| |
|
|||||||||||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
1884484 |
aataatgatatgaaagatacaagtccaagtaggaatcaactagttcct |
1884531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0200 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 405 - 451
Target Start/End: Original strand, 20400 - 20446
Alignment:
| Q |
405 |
gaataatgatatgaaagatacaagttctagcaggaatcaactagttc |
451 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||||||| ||||||| |
|
|
| T |
20400 |
gaatcatgatatgaaagataaaagttcaagcaggaatcagctagttc |
20446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University