View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2715_low_22 (Length: 325)
Name: NF2715_low_22
Description: NF2715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2715_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 19904858 - 19904712
Alignment:
| Q |
1 |
gcaactgctgtagcagatggaagtggaattgatacttttatatggccaccctattgtataacttggtacaatcagtgcgtccttaatccgggaagcatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19904858 |
gcaactgctgtagcagatggaagtggaattgatacatttatatggccaccctattgtataacttggtacaatcggtgcgtccttaatccgggaagcatca |
19904759 |
T |
 |
| Q |
101 |
cttgtactaagttctccctctactgcactctaaagaacccagctgct |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19904758 |
cttgtactaagttctccctctactgcactctaaagaacccagctgct |
19904712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 258 - 313
Target Start/End: Complemental strand, 19904541 - 19904486
Alignment:
| Q |
258 |
gaatgaaggttttatttaaataattcaattgtattcttaactttcctattgttaat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19904541 |
gaatgaaggttttatttaaataattcaattgtattcttaacttttctattgttaat |
19904486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 147 - 188
Target Start/End: Complemental strand, 19904652 - 19904611
Alignment:
| Q |
147 |
taagggagggccacttattatagtgtgatactctataatgtc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19904652 |
taagggagggccacttattatagtgtgatactctataatgtc |
19904611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University