View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2715_low_25 (Length: 268)
Name: NF2715_low_25
Description: NF2715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2715_low_25 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 268
Target Start/End: Original strand, 31162395 - 31162650
Alignment:
| Q |
20 |
ccaaggagctctgatccaatggattcacctttgttgagcttagaatcatccctaaatgcaaaaataccttttctttggagttaggacag-------tgta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31162395 |
ccaaggagctctgatccaatggattcacctttgttgagcttagaatcatccctaaatgcaaaaataccttttctttggagttaggacaggagatagtgta |
31162494 |
T |
|
| Q |
113 |
actaatagcgtctgaaatgtggaattaaacaaagcaagcattcccgtttttaccatttcaagtttcaacttcaagcatgcttcttcctagcttcttattc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31162495 |
actaatagcgtctgaaatgtggaattaaacaaagcaagcattcccgtttttaccatttcaagtttcaacttcaagcatgcttcttcctagcttcttattc |
31162594 |
T |
|
| Q |
213 |
ttagcaatagcatgttagttgannnnnnnctcaaagatagtaaggttcccacatct |
268 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
31162595 |
ttagcaatagcatgttagttgatttttttctcaaagatagtaaagttcccacatct |
31162650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 96
Target Start/End: Original strand, 31160035 - 31160093
Alignment:
| Q |
38 |
atggattcacctttgttgagcttagaatcatccctaaatgcaaaaataccttttctttg |
96 |
Q |
| |
|
|||||||||||||| || || |||||||||||||| ||||||| || ||||||||||| |
|
|
| T |
31160035 |
atggattcacctttcttcaggttagaatcatccctgaatgcaacgatgccttttctttg |
31160093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University