View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2715_low_33 (Length: 222)
Name: NF2715_low_33
Description: NF2715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2715_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 206
Target Start/End: Original strand, 31162395 - 31162588
Alignment:
| Q |
20 |
ccaaggagctctgatccaatggattcacctttgttgagcttagaatcatccctaaatgcaaaaataccttttctttggagttaggacag-------tgta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31162395 |
ccaaggagctctgatccaatggattcacctttgttgagcttagaatcatccctaaatgcaaaaataccttttctttggagttaggacaggagatagtgta |
31162494 |
T |
 |
| Q |
113 |
actaatagcgtctgaaatgtggaattaaacaaagcaagcattcccgtttttaccatttcaagtttcaacttcaagcatgcttcttcctagcttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31162495 |
actaatagcgtctgaaatgtggaattaaacaaagcaagcattcccgtttttaccatttcaagtttcaacttcaagcatgcttcttcctagcttc |
31162588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 96
Target Start/End: Original strand, 31160035 - 31160093
Alignment:
| Q |
38 |
atggattcacctttgttgagcttagaatcatccctaaatgcaaaaataccttttctttg |
96 |
Q |
| |
|
|||||||||||||| || || |||||||||||||| ||||||| || ||||||||||| |
|
|
| T |
31160035 |
atggattcacctttcttcaggttagaatcatccctgaatgcaacgatgccttttctttg |
31160093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University