View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2716_low_13 (Length: 214)
Name: NF2716_low_13
Description: NF2716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2716_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 34824729 - 34824804
Alignment:
| Q |
1 |
cctcagtttagtcaatgagttaactcgtacgagatcagacaaaatcaattgagggaagaattaaacggatattatt |
76 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34824729 |
cctcagtttagtcaatgagttaacttgtatgagatcagacaaaatcaattgagggaagaattaaacggatattatt |
34824804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 122 - 197
Target Start/End: Original strand, 34824805 - 34824880
Alignment:
| Q |
122 |
atcttgaggtacatataaactttatattctaannnnnnnnatcttctcaaataaaataaaaatttttggaaattcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||| |
|
|
| T |
34824805 |
atcttgaggtacatataaactttatattctaattttatttatcttctcaaataaaatttaattttttggaaattcc |
34824880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University