View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717R-Insertion-11 (Length: 328)
Name: NF2717R-Insertion-11
Description: NF2717R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717R-Insertion-11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 8 - 157
Target Start/End: Original strand, 53924717 - 53924866
Alignment:
| Q |
8 |
aattctatttgtcacacttgtgaatgaacaagaaaaccttgaattgaagttgattcaatttacagtgtggtgtgtttcgtttcgagttggtgcacatttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53924717 |
aattctatttgtcacacttgtgaatgaacaagaaaaccttgaattgaagttgattcaatttacagtgtggtgtgtttcgtttagagttggtgcacatttc |
53924816 |
T |
 |
| Q |
108 |
aaagcacctctaacatcaatctaaacacactatttagtgtttgctgttaa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53924817 |
aaagcacctctaacatcaatctaaacacactatttagtgtttgctgttaa |
53924866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 108 - 146
Target Start/End: Original strand, 53924880 - 53924918
Alignment:
| Q |
108 |
aaagcacctctaacatcaatctaaacacactatttagtg |
146 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
53924880 |
aaagcacctctaacatcaatctaaacatactaattagtg |
53924918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University