View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717R-Insertion-14 (Length: 120)
Name: NF2717R-Insertion-14
Description: NF2717R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717R-Insertion-14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 7e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 52582217 - 52582329
Alignment:
| Q |
8 |
agggagtatagtgaacaacaaaagggagtatcgtgaacaaaaaataatataacgaaaattaatttcatgaattaactaaaagtagaaaaagtacacagta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52582217 |
agggagtatagtgaacaacaaaagggagtatcgtgaacaacaaataatataacgaaaattaatttcatgcattaactaaaagtagaaaaagtacacagta |
52582316 |
T |
|
| Q |
108 |
atcattagttctc |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52582317 |
atcattagttctc |
52582329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University