View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717R-Insertion-15 (Length: 56)
Name: NF2717R-Insertion-15
Description: NF2717R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717R-Insertion-15 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 3e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 3e-19
Query Start/End: Original strand, 9 - 56
Target Start/End: Complemental strand, 18422027 - 18421980
Alignment:
| Q |
9 |
ttgtccaccactacgaccaccatcaatcactactttgaccaccgttga |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18422027 |
ttgtccaccactacgaccaccatcaatcactactttgaccaccgttga |
18421980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 9 - 43
Target Start/End: Complemental strand, 18435543 - 18435509
Alignment:
| Q |
9 |
ttgtccaccactacgaccaccatcaatcactactt |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
18435543 |
ttgtccaccactacgaccaccatcaatcactactt |
18435509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University