View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717_high_27 (Length: 391)
Name: NF2717_high_27
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717_high_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 336; Significance: 0; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 18 - 381
Target Start/End: Complemental strand, 32346235 - 32345872
Alignment:
| Q |
18 |
aaaacatcaattgcgaggtattgtttcttaatcaacttggttcttacagtggtaccataatttcgtttatttctcttaagataacacaaaaataaaatgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32346235 |
aaaacatcaattgcgaggtattgtttcttaaccaacttgattcttacagtggtaccataatttcgtttatttctcttaagataacacaaaaataaaatgt |
32346136 |
T |
 |
| Q |
118 |
atactttaggatgtctacgtcagccttgttgttccacctttacctcattgaacctcgaaacatcttttgccttcttgaatacttgcctccaactacactg |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32346135 |
atactttaggatgtttacgtcagccttgttgttccacctttacctcattgaacctcgaaacatcttttgccttcttgaatacttgcctccaactacactg |
32346036 |
T |
 |
| Q |
218 |
agccttttaagtagctccataacttatcaccattacctcttcaacctctggattgattaatttatgtcctcttgaagatcttcttgccttcaattaccct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32346035 |
agccttttaagtagctccataacttatcaccataacctcttcaacctctggattgattaatttatgtcctcttgaagatcttcttgtcttcaattaccct |
32345936 |
T |
 |
| Q |
318 |
tggtcttttaggaatcccacaagtcgttccataccttcttcaacccctgaaatgtgcttctctg |
381 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32345935 |
tggtcttttaggaatcccacaagtcgtttcataccttcttcaactcctgaaatgtgcttctctg |
32345872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 281 - 361
Target Start/End: Original strand, 10456153 - 10456234
Alignment:
| Q |
281 |
atgtcctcttgaagatcttcttgccttcaattacccttggtcttttagg-aatcccacaagtcgttccataccttcttcaac |
361 |
Q |
| |
|
||||| ||||||| |||| ||| | | |||| ||||||||||||||||| |||||||||||| || |||||| ||||||||| |
|
|
| T |
10456153 |
atgtcttcttgaatatctccttacatccaatcacccttggtcttttaggtaatcccacaagttgtgccatacattcttcaac |
10456234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 283 - 364
Target Start/End: Original strand, 37048262 - 37048344
Alignment:
| Q |
283 |
gtcctcttgaagatcttcttgccttcaattacccttggtcttttagg-aatcccacaagtcgttccataccttcttcaacccc |
364 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||| ||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
37048262 |
gtcctcttgaagattctcttgcctccaattacccttggtcttttaggtaatcccataagccattccataccttcttcaacccc |
37048344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 287 - 360
Target Start/End: Original strand, 29797096 - 29797170
Alignment:
| Q |
287 |
tcttgaagatcttcttgccttcaattacccttggtcttttagg-aatcccacaagtcgttccataccttcttcaa |
360 |
Q |
| |
|
|||||||||| | ||||| | |||||||| ||||||||||||| ||||||||||||| |||||||| ||| |||| |
|
|
| T |
29797096 |
tcttgaagatttccttgcatgcaattaccattggtcttttaggtaatcccacaagtcattccatacattcctcaa |
29797170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University