View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717_high_34 (Length: 334)
Name: NF2717_high_34
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717_high_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 53924720 - 53924866
Alignment:
| Q |
1 |
tctatttgtcacacttgtgaatgaacaagaaaaccttgaattgaagttgattcaatttacagtgtggtgtgtttcgtttcgagttggtgcacatttcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53924720 |
tctatttgtcacacttgtgaatgaacaagaaaaccttgaattgaagttgattcaatttacagtgtggtgtgtttcgtttagagttggtgcacatttcaaa |
53924819 |
T |
 |
| Q |
101 |
gcacctctaacatcaatctaaacacactatttagtgtttgctgttaa |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53924820 |
gcacctctaacatcaatctaaacacactatttagtgtttgctgttaa |
53924866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 53924880 - 53924918
Alignment:
| Q |
98 |
aaagcacctctaacatcaatctaaacacactatttagtg |
136 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
53924880 |
aaagcacctctaacatcaatctaaacatactaattagtg |
53924918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University