View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717_high_37 (Length: 310)
Name: NF2717_high_37
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 28407282 - 28407168
Alignment:
| Q |
1 |
aatatacatatttggaaaagaatcaagatttctacacaactaggtatatcaattggtatatcattttccacttttatga-tatctccataaataaatatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
28407282 |
aatatacatatttggaaaagaatcaagatttttacacaactaggtatatcaattggtatatcattttccacttgtatgattatctccataaataaatatg |
28407183 |
T |
 |
| Q |
100 |
aggtattaggtaaaa |
114 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28407182 |
aggtattaggtaaaa |
28407168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 137 - 210
Target Start/End: Complemental strand, 28406941 - 28406868
Alignment:
| Q |
137 |
agggttgcattgttgttgctccctttttcttttattttaaggctgctccccttttttagggtttatgatgcaac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28406941 |
agggttgcattgttgttgctccctttttcttttattttaaggctgctccccttttttagagtttatgatgcaac |
28406868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University