View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2717_high_42 (Length: 275)

Name: NF2717_high_42
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2717_high_42
NF2717_high_42
[»] chr7 (6 HSPs)
chr7 (1-261)||(46961370-46961632)
chr7 (202-246)||(28545524-28545569)
chr7 (202-246)||(28549939-28549984)
chr7 (202-246)||(28556107-28556152)
chr7 (202-246)||(47958511-47958556)
chr7 (202-246)||(48253883-48253928)
[»] chr4 (1 HSPs)
chr4 (202-246)||(33075824-33075869)
[»] chr3 (2 HSPs)
chr3 (202-246)||(21127742-21127787)
chr3 (202-246)||(43291871-43291916)
[»] chr2 (1 HSPs)
chr2 (202-246)||(36011914-36011959)
[»] chr1 (2 HSPs)
chr1 (202-246)||(2736202-2736247)
chr1 (202-246)||(39959870-39959915)


Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 6)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 46961632 - 46961370
Alignment:
Q  1 attaccaaagactccgtcattgtcttcatcagaactcttcattaaggaactgtaactagacggactttctcaccatttatggcagccaacgactaactcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46961632 attaccaaagactccgtcattgtcttcatcagaactcttcattaaggaactgtaactagacggactttctcaccatttatggcagccaacgactaactcc 46961533  T
Q  101 aactgcattttcggtgagcttttggtttttcccgatagtggagttttgggaaactccaacttgtttttctcatatacaagccccaaacaagaaaagttta 200  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46961532 aactgcattttcggtgagcttttggtttttcccggtagtggagttttgggaaactccaacttgtttttctcatatacaagccccaaacaagaaaagttta 46961433  T
Q  201 -ggtgggatttgaaccc-cgccttttcagaccagaaccttaatctggcacgctttagaccata 261  Q
     |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  46961432 gggtgggatttgaacccacgccttttcagaccagaaccttaatctggcacgctttagaccata 46961370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 28545569 - 28545524
Alignment:
Q  202 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 246  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
T  28545569 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 28545524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 28549984 - 28549939
Alignment:
Q  202 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 246  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
T  28549984 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 28549939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 28556152 - 28556107
Alignment:
Q  202 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 246  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
T  28556152 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 28556107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 246
Target Start/End: Original strand, 47958511 - 47958556
Alignment:
Q  202 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 246  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
T  47958511 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 47958556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 48253928 - 48253883
Alignment:
Q  202 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 246  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
T  48253928 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 48253883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 33075869 - 33075824
Alignment:
Q  202 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 246  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
T  33075869 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 33075824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 246
Target Start/End: Original strand, 21127742 - 21127787
Alignment:
Q  202 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 246  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
T  21127742 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 21127787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 246
Target Start/End: Original strand, 43291871 - 43291916
Alignment:
Q  202 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 246  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
T  43291871 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 43291916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 36011959 - 36011914
Alignment:
Q  202 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 246  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
T  36011959 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 36011914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 2736247 - 2736202
Alignment:
Q  202 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 246  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
T  2736247 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 2736202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 39959915 - 39959870
Alignment:
Q  202 gtgggatttgaaccc-cgccttttcagaccagaaccttaatctggc 246  Q
    ||||||||||||||| |||| |||| ||||||||||||||||||||    
T  39959915 gtgggatttgaacccacgccctttcggaccagaaccttaatctggc 39959870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University