View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717_low_13 (Length: 535)
Name: NF2717_low_13
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 1e-60; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 399 - 525
Target Start/End: Original strand, 43343803 - 43343929
Alignment:
| Q |
399 |
cttcccacatatcccaatataatgatgatatcacaatcgagaaaggaatctgctgtagcacattgtctcgtgtgactaacaacatcctgctgctcatctt |
498 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43343803 |
cttcccacatatcccaatataatgatgatatcacaatcgagaaaggaatctgctgtagcacattgtatcgtgtgactaacaacatcctgctgctcatctt |
43343902 |
T |
 |
| Q |
499 |
gccgttcgattagtgttggtatctgtg |
525 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
43343903 |
gccgttcgattagtgttggtatttgtg |
43343929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 17 - 123
Target Start/End: Original strand, 43343399 - 43343505
Alignment:
| Q |
17 |
agtaactaatcatgttaacttaaaactgttaattggttaatcaaagattcgtttagttggataagatagttctattatgagataaacacaaattctaggg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43343399 |
agtaactaatcatgttaacttaaaactgttaattggttaatcaaagattcgtttagttggataagatagttctattatgagataaacacaaattctaggg |
43343498 |
T |
 |
| Q |
117 |
ctaattt |
123 |
Q |
| |
|
||||||| |
|
|
| T |
43343499 |
ctaattt |
43343505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 248 - 315
Target Start/End: Original strand, 43343630 - 43343697
Alignment:
| Q |
248 |
aaaagggagaggatttgcatgatccatagttgcaggtcttgtgcaataaaaacatgcagatcccatga |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43343630 |
aaaagggagaggatttgcatgatccatagttgcaggtcttgtgcaataaaaacatgcagatcccatga |
43343697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 43343537 - 43343587
Alignment:
| Q |
155 |
tttagttgcttttttgatatgtcagaaaattgatggatgggatagcaatgg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43343537 |
tttagttgcttttttgatatgtcagaaaattgatggatgggatagcaatgg |
43343587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University