View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717_low_25 (Length: 408)
Name: NF2717_low_25
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 17 - 396
Target Start/End: Complemental strand, 31786316 - 31785934
Alignment:
| Q |
17 |
aaataagatctatatttccaagtatattaagcacacttagaaaaatatgagtataaa--atgaaaaattatcactagaa-gatcaaaattacaaaattta |
113 |
Q |
| |
|
||||||||||||| ||| |||||||||||| | |||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31786316 |
aaataagatctatcttttcaagtatattaaacccacttacaaaaatatgagtataaattatgaaaaattatcactagaatgatcaaaattacaaaattta |
31786217 |
T |
 |
| Q |
114 |
gtgttattctaatgatttaaaagtggcaatttgttgtgtattgaactctatggttgagggcaggcatttctctctttgtttctatcaatccaaacatatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31786216 |
gtgttattctaatgatttaaaagtggcaatttgttgtgtattgaactctatgattgagggcaggcatttctctctttgtttctatcaatccaaacatatt |
31786117 |
T |
 |
| Q |
214 |
tctttcaattggcttttgggggctagtgcttggtttctgttcttctatattttcagcattgttttcactcaaatcttgtatgtccaatatctcaactctt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31786116 |
tctttcaattggcttttgggggctagtgcttggtttctgttcttctatattttcagcattgttttcactcaaatcttgtatgtccaatatctcaactctt |
31786017 |
T |
 |
| Q |
314 |
cgatttgttttcttttttatcttgattgcaacatcttgagggatgaaactgccacacacaattaccctggtttgcttcatctc |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31786016 |
cgatttgttttcttttttatcttgattgcaacatcttgagggatgaaactgccacacacaattaccctggtttgcttcttctc |
31785934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University