View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717_low_31 (Length: 369)
Name: NF2717_low_31
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 76 - 235
Target Start/End: Original strand, 34329136 - 34329295
Alignment:
| Q |
76 |
catgacccttgcaatgtaacatttgaagggtgcatgcatcaacatcaaaatgaaacaactatgtcgcaaaagcaaaagaagtaacacgaggtgtattgtt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34329136 |
catgacccttgcaatgtaacatttgaagggtgcatgcatcaacatcaaaatgaaacaactatgtcgcaaaagcaaaagaagtaacacgaggtgtattgtt |
34329235 |
T |
 |
| Q |
176 |
gctatttctttgatgagaatgagaagacctagcaagtggtggtttattaatatttacacc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34329236 |
gctatttctttgatgagaatgagaagacctagcaagtggtggtttattaatatttacacc |
34329295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 253 - 357
Target Start/End: Original strand, 34329289 - 34329393
Alignment:
| Q |
253 |
ttacaccaccaccattcacttgtttccatgctgacgtggcccctctttgtccctcacatttcgctggctgtggacccacactaaccgctttctcacaccg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34329289 |
ttacaccaccaccattcacttgtttccatgctgacgtggcccctctttgtccctcacatttcactggctgtggacccacactaaccgctttctcacaccg |
34329388 |
T |
 |
| Q |
353 |
acagc |
357 |
Q |
| |
|
||||| |
|
|
| T |
34329389 |
acagc |
34329393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University