View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717_low_51 (Length: 255)
Name: NF2717_low_51
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 8 - 239
Target Start/End: Complemental strand, 2507883 - 2507648
Alignment:
| Q |
8 |
acatcatcatttaaaagaaaagtaaaataactatattaggaagatgacaaattctcccacctttgattgataatttaagaattggtaaaacattaacgat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2507883 |
acatcatcatttaaaagaaaagtaaaataactatattaggaagatgacaaattctcccacctttgattgataattcaagaattggtaaaacattaacgat |
2507784 |
T |
 |
| Q |
108 |
gcctaactttgactcaataaag----nnnnnnnnnctttgagaggactcgatcaacattcatttggcaaaataaagggtgtctaaaatatattttccaac |
203 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2507783 |
gcctaactttgactcaatcaaggtttttttcttttctttgagaggactcgatcaacgttcatttggcaaaataaagggtgtctaaaatttattttccaac |
2507684 |
T |
 |
| Q |
204 |
atatattattactgcgtcgttataagaggaccagtt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2507683 |
atatattattactgcgtcgttataagaggaccagtt |
2507648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University