View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717_low_58 (Length: 238)
Name: NF2717_low_58
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717_low_58 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 30239515 - 30239328
Alignment:
| Q |
16 |
cactagcaatctcaaaaagagttctttctctccaatattcctcaggaagttccataattttgatcaacgcccgagcatgcgtttatcattgagtacaagg |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| || |
|
|
| T |
30239515 |
cactagcaatctcaaaaggagttctttctctccaatattcctcaggaagttccataattttgatcgacacccgagcatgcgtttatcattgagtacaggg |
30239416 |
T |
|
| Q |
116 |
attaaaatcattggaccgtataaataaacgcaagaaaccaggcttaaggttccatgttcccatggatcatactcttctcatatatcat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30239415 |
attaaaatcattggaccgtataaataaacgcaagaaaccaggcttaaggttccatgttcccatggatcatactcttctcatatatcat |
30239328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University