View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717_low_59 (Length: 236)
Name: NF2717_low_59
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 119 - 221
Target Start/End: Original strand, 42570124 - 42570226
Alignment:
| Q |
119 |
aaacagttatttaaattttcttgattggattttttatcagggaatatgaagaatctccgatgaactttggaattcactttgtgccggatcagacagtata |
218 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42570124 |
aaacaattatttaaattttcttgattgaattttttatcagggaatatgaagaatctccgatgaactttggaattcactttgtgccggatcagacagtata |
42570223 |
T |
 |
| Q |
219 |
tat |
221 |
Q |
| |
|
||| |
|
|
| T |
42570224 |
tat |
42570226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 42569935 - 42570010
Alignment:
| Q |
1 |
ctcgactctcctcggtccgtcatcttcgcagttaccgagatcatatctccaggttggttaactttcttctcattaa |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42569935 |
ctcgactctcctcggtccgtcatcttcgcagttaccgagatcatatctccaggttagttaactttcttctcattaa |
42570010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 154 - 221
Target Start/End: Original strand, 42577348 - 42577415
Alignment:
| Q |
154 |
atcagggaatatgaagaatctccgatgaactttggaattcactttgtgccggatcagacagtatatat |
221 |
Q |
| |
|
|||||| |||||| |||| |||||||||||||||||||| ||||||||||||| |||||||| ||||| |
|
|
| T |
42577348 |
atcaggcaatatgcagaacctccgatgaactttggaattaactttgtgccggagcagacagtgtatat |
42577415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 223
Target Start/End: Original strand, 42594055 - 42594103
Alignment:
| Q |
175 |
ccgatgaactttggaattcactttgtgccggatcagacagtatatattg |
223 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42594055 |
ccgataaacttcggaattcactttgtgccggagcagacagtatatattg |
42594103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University