View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717_low_61 (Length: 224)
Name: NF2717_low_61
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717_low_61 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 210
Target Start/End: Complemental strand, 1786493 - 1786300
Alignment:
| Q |
17 |
gaaaagagtaaacaaaatttcaaactctcatgccacaataagtacttnnnnnnnnttaattaccaaatagccattctgaaagacttccatttggacatag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1786493 |
gaaaagagtaaacaaaatttcaaactctcatgccacaataagtacttaaaaaaaattaattaccaaatagccattctgaaagacttccatttggacatag |
1786394 |
T |
 |
| Q |
117 |
ttcatagataagaagacattcatctccatcaacacaacagccaagcaaagaaacaagattttggtgcttgacatgagatagacttgtaacttct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1786393 |
ttcatagataagaagacattcatctccatcaacacaacagccaagcaaagaaacaagattttggtgcttgacatgagatagacttgtaacttct |
1786300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University