View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717_low_62 (Length: 221)
Name: NF2717_low_62
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717_low_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 53 - 177
Target Start/End: Complemental strand, 11975551 - 11975427
Alignment:
| Q |
53 |
cggaaaaggcaaccttgttgtgctggataacttgaaaactgagatacttggtgatgagatgctctctgatttggacaagatattaatgacatccaatggt |
152 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11975551 |
cggaaaaggaaaccttgttgtgctggataatttgaaaactgagatacttggggacgagatgctctctgatttggacaagatattaatgacgtccaatggt |
11975452 |
T |
|
| Q |
153 |
gcaagtgcaatactcataaccacac |
177 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
11975451 |
gcaagtgcaattctcataaccacac |
11975427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University