View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2717_low_63 (Length: 216)
Name: NF2717_low_63
Description: NF2717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2717_low_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 102 - 212
Target Start/End: Complemental strand, 19417044 - 19416933
Alignment:
| Q |
102 |
tcctggtatagttggcaactttgtggtccaactttctaatcattaattaccataaactagggacagagccacaaatcaaactta-ggaggaccaagttga |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19417044 |
tcctggtatagttgataactttgtggtccaactttctaatcattaattactataaactagggacagagccacaaatcaaacttagggaggaccaagttga |
19416945 |
T |
 |
| Q |
201 |
aagtataattta |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
19416944 |
aagtataattta |
19416933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University