View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2719_high_12 (Length: 275)
Name: NF2719_high_12
Description: NF2719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2719_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 147 - 257
Target Start/End: Complemental strand, 12669475 - 12669365
Alignment:
| Q |
147 |
gaaatgtagtaattgtagctagcatgctttcatcacgtccttaatatccttcacaataaaatttaaacaaaattttcttaagtgcatgtgtgttatcaag |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
12669475 |
gaaatgtagtaattgtagctagcatgctttcatcatgtccttaatatccttcacaataaaatttaaataaaattttcttaagtgcatgtatgttatcaag |
12669376 |
T |
|
| Q |
247 |
caattcacttt |
257 |
Q |
| |
|
||||||||||| |
|
|
| T |
12669375 |
caattcacttt |
12669365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 12669621 - 12669523
Alignment:
| Q |
1 |
gtctatccctcctgagctagttccattttcgccattaatggcttgaaaattggatgnnnnnnnnggaccttgcaaattgtaatgtgcaaattggttcta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12669621 |
gtctatccctcctgagctagttccattttcgccattaatggcttgaaaattggatgaaaaaaaaggaccttgcaaattgtaatgtgcaaattggttcta |
12669523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University