View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2719_high_14 (Length: 224)
Name: NF2719_high_14
Description: NF2719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2719_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 21 - 206
Target Start/End: Original strand, 3213882 - 3214067
Alignment:
| Q |
21 |
gagaccaaggaaaactatatgcctatgttttctttccaaaacaccattttggtggtgagcgtgcgggcagattgggtaattcctaaagtggcaaggtatt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3213882 |
gagaccaaggaaaactatatgcctatgttttctttccaaaacaccattttggtggtgagcgtgtgggaagattgggtaattcctaaagtggcaaggtatt |
3213981 |
T |
 |
| Q |
121 |
gagtgaaaggtctatactcccttccccaatcagtttgcaaagattagttttaaaagaaggtgaatgcaatctatgagctttgccca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3213982 |
gagtgaaaggtctatactcccttccccaatcagtttgcaaagattagttttaaaagaaggtgaatgcaatctatgagctttgccca |
3214067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 79
Target Start/End: Complemental strand, 39580741 - 39580695
Alignment:
| Q |
33 |
aactatatgcctatgttttctttccaaaacaccattttggtggtgag |
79 |
Q |
| |
|
|||||| ||||| ||||||||||||| |||||||||||| ||||||| |
|
|
| T |
39580741 |
aactatgtgcctgtgttttctttccacaacaccattttgatggtgag |
39580695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 74
Target Start/End: Original strand, 32458946 - 32458986
Alignment:
| Q |
34 |
actatatgcctatgttttctttccaaaacaccattttggtg |
74 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
32458946 |
actatatgcctatgttttctctccacaacaccattttggtg |
32458986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University