View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2719_high_2 (Length: 556)
Name: NF2719_high_2
Description: NF2719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2719_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 314; Significance: 1e-177; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 18 - 331
Target Start/End: Complemental strand, 12670147 - 12669834
Alignment:
| Q |
18 |
ataataatatacataaaatttctatttataaatctaaagctggctagtactgctcctgccattctttcttcattctctgcaatcactaattaagagtatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12670147 |
ataataatatacataaaatttctatttataaatctaaagctggctagtactgctcctgccattctttcttcattctctgcaatcactaattaagagtatg |
12670048 |
T |
|
| Q |
118 |
attcatatgatacaggtcccaataaggaaaatctcatgcatgtgatgagtactagtaggagcaagttcatgaccaccatggtcaaccctttgagattctg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12670047 |
attcatatgatacaggtcccaataaggaaaatctcatgcatgtgatgagtactagtaggagcaagttcatgaccaccatggtcaaccctttgagattctg |
12669948 |
T |
|
| Q |
218 |
tgacaaaaaagaagaagacattggtggctctgaaattgtagctgacaattcttcagcaacttcagcattagcagcaggttcattctaatcatcatgggtg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12669947 |
tgacaaaaaagaagaagacattggtggctctgaaattgtagctgacaattcttcagcaacttcagcattagcagcaggttcattctaatcatcatgggtg |
12669848 |
T |
|
| Q |
318 |
ctatcctatctgag |
331 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12669847 |
ctatcctatctgag |
12669834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 170; E-Value: 6e-91
Query Start/End: Original strand, 373 - 546
Target Start/End: Complemental strand, 12669795 - 12669622
Alignment:
| Q |
373 |
actctacttgtgtcttcttgaccttgtaagaccttttcttgaccttgtaagacctcactctgtgtcggttttctttgtttttgcttttgtggaagacgct |
472 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12669795 |
actctacttgtgtcttcttgaccttgtaagaccttttcttgaccttgtaagacctcactctgtgtcggttttctttgtttttgcttttgtggaagacgct |
12669696 |
T |
|
| Q |
473 |
atatcgaaatttgtcgatatagagtttcgtctccgtttttcccttttaccacccaactcattctctcttttctt |
546 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12669695 |
atatcgaaatttgttgatatagagtttcgtctccgtttttcccttttaccacccaactcattctctcttttctt |
12669622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University