View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2719_low_11 (Length: 306)
Name: NF2719_low_11
Description: NF2719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2719_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 291
Target Start/End: Complemental strand, 27300422 - 27300150
Alignment:
| Q |
19 |
ttttcatgtttcctcaatactctatgggtgcacatcagaacatcacgtgctaccctaccaaccataatcagtcacgtgccatggcagatatagaagtgac |
118 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27300422 |
ttttcatgtttcctcaatactctatggatgcacgtcagaacatcacgtgctaccctaccaaacataatcagtcacgtgccatgggagatatagaagtgac |
27300323 |
T |
 |
| Q |
119 |
tttggttgatagtcaagcgaatataaagataatgttgaaaaaacgacaaggacaggttatgaagatggttgttgggattcaaaatcttggctttaatatt |
218 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||| |
|
|
| T |
27300322 |
tttggttgatagtcatgcgaatataaagataatgttgaaaaaacgacaaggacaggttatgaagatggttgctgggattcaaaatcttggcttcaacatt |
27300223 |
T |
 |
| Q |
219 |
ctacaccttaatgtttccagtgtggatgataatgtccttgtctcggttagtgctaaggtaaattggtttacat |
291 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27300222 |
ctacaccttaatgtttccagtatggatgataatgttcttgtctcggttagtgccaaggtaaattggtttacat |
27300150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University