View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2719_low_17 (Length: 218)
Name: NF2719_low_17
Description: NF2719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2719_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 36133084 - 36133280
Alignment:
| Q |
16 |
gaagaatgaagcagaagcgtacatgcttaaagagttatctctcttaaaatggaaagagaaggctacgaagctagctgttgctgatacaggtggaaaaatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36133084 |
gaagaatgaagcagaagcgtacatgcttaaagagttatctctcttaaaatggaaagagaaggctacgaagctagctgttgctgatacaggtggaaaaatg |
36133183 |
T |
|
| Q |
116 |
gatgagttaca-------------agcctagaagaaaatcttaaggcggaagggtaacttttaatttcatctattgtctttctctatatatacatac |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36133184 |
gatgagttacaagagtgtgttgctagcctagaagaaaatcttaaggcggaaaggtaacttttaatttcatctattgtctttctctatatatacatac |
36133280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 16 - 128
Target Start/End: Original strand, 30813437 - 30813549
Alignment:
| Q |
16 |
gaagaatgaagcagaagcgtacatgcttaaagagttatctctcttaaaatggaaagagaaggctacgaagctagctgttgctgatacaggtggaaaaatg |
115 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||| || |||||| ||||||||||||| | ||||||||||| ||||||||| ||||||||| |
|
|
| T |
30813437 |
gaagaatgaagcagaagcatacatgctcaaagagttatctctgttgaaatggcaagagaaggctacaacgctagctgttgatgatacagggggaaaaatg |
30813536 |
T |
|
| Q |
116 |
gatgagttacaag |
128 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30813537 |
gatgagttacaag |
30813549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University