View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2720_high_5 (Length: 250)
Name: NF2720_high_5
Description: NF2720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2720_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 247
Target Start/End: Complemental strand, 23159640 - 23159410
Alignment:
| Q |
16 |
atgaagaaaatgaggaccaaactatgagacaaatataataaaaggaataaatgaacataaccaaaaagaagaagaaatgagcgccctctcgttgctgccg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23159640 |
atgaagaaaatgaggaccaaactatgagacaaatataataaaaggaataaatgaacataacaaaaaagaagaagaaatgagcgccctctcgttgctgccg |
23159541 |
T |
|
| Q |
116 |
gtggcactctaactacggtgattgcacccttgcgcttacgtcattgtgagacgaccacttcatcccccttttgccgatgctttctctcactgcagtaacc |
215 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23159540 |
gtggcactctaactacggtggttgc-cccttgcgcttacgtcattgtgagacgaccacttcattccccttttgccgatgctttctctcactgcagtaacc |
23159442 |
T |
|
| Q |
216 |
aaatttaggacaaacactaatggttggattta |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23159441 |
aaatttaggacaaacactaatggttggattta |
23159410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 16 - 247
Target Start/End: Complemental strand, 20023132 - 20022905
Alignment:
| Q |
16 |
atgaagaaaatgaggaccaaactatgagacaaatataataaaaggaataaatgaacataaccaaaaagaagaagaaatgagcgccctctcgttgctgccg |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||| | |||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
20023132 |
atgaagaaaatgaggaccaaacaatgagacaaatagaataaaaggaataaattaccataaccaaaaagaagaa---atgagccccctctcgttgctgccg |
20023036 |
T |
|
| Q |
116 |
gtggcactctaactacggtgattgcacccttgcgcttacgtcattgtgagacgaccacttcatcccccttttgccgatgctttctctcactgcagtaacc |
215 |
Q |
| |
|
|||||| ||||||||| | ||| || |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
20023035 |
gtggcattctaactaccgcgatcgc-cccttgcgcttatgtcattgtgagacgaccactacatcccccttttgccgatgctttatctcactgccataacc |
20022937 |
T |
|
| Q |
216 |
aaatttaggacaaacactaatggttggattta |
247 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
20022936 |
aaatttaggaaaaacactaatggttggattta |
20022905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University