View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2721_low_2 (Length: 423)
Name: NF2721_low_2
Description: NF2721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2721_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 38212829 - 38213135
Alignment:
| Q |
1 |
ctaaaccgtacttttacgagaaactagtatgacctttcgacacatagaagtatagaaccgctagttatagacgatcaacaagaagnnnnnnnaagattta |
100 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38212829 |
ctaaaccgcgcttttccgagaaactagtatgccctttcgatacatagaa--------ccgctagttatagacgatcaacaagaagtttttttaagattta |
38212920 |
T |
 |
| Q |
101 |
aatatgcagaatttgcatctcaaattagttatagattatgcatgcttataattattccttttgtattttatttacttcatagctaatttcaatattttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38212921 |
aatatgcagaatttgcatctcaaattagttatagattatgcatgcttataattattccttttgtattttatttacttcataactaatttcaatattttat |
38213020 |
T |
 |
| Q |
201 |
----ttcatataatacatattgcttctagagtttcannnnnnncttaatttgatccgagcactattatgctgtgaataaaacatcatttatacttaattg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38213021 |
ttacttcatataatacatattgcttctagagtttcatttttttcttaatttgatccgagcaccattatgctgtgaataaaacatcatttatacttaattg |
38213120 |
T |
 |
| Q |
297 |
tcaggagtgaacaaa |
311 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
38213121 |
tcaagagtgaacaaa |
38213135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 330 - 411
Target Start/End: Original strand, 38213125 - 38213206
Alignment:
| Q |
330 |
gagtgaacaaaattgaattgcaatttcttatttactatttatggtgaatttagctttggcaaatatctcaacctctgtccat |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38213125 |
gagtgaacaaaattgaattgcaatttcttatttactatgtatggtgaatttagctttggcaaatatctcaacctctgtccat |
38213206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University