View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2721_low_4 (Length: 322)
Name: NF2721_low_4
Description: NF2721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2721_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 43 - 317
Target Start/End: Complemental strand, 43076486 - 43076212
Alignment:
| Q |
43 |
tgtgattgggaactatacaaaaattggcttgtgtcatggttttatatacaagttatgttattcaggtgggaccatatattaactgaagctgaatcagaga |
142 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43076486 |
tgtgatttggaactatacaaaaattggcttgtgtcatggttttatatacaagttatgttattcaggtgggaccatatattaagtgaagctgaatcagaga |
43076387 |
T |
 |
| Q |
143 |
atcatttacagagagatagatagataggtcacgggtgcattgcatctattgatatatgttcaaagaaattaagagagatgaacaatctaaattctaaacc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43076386 |
atcatttacagagagatagatagataggtcacgggtgcattgcatctattgatatatgttcaaagaaattaagagagatgaacaatctaaattctaaacc |
43076287 |
T |
 |
| Q |
243 |
acaggcacgggacatgttgcactttttgttcataaaattgttcttttaatattttttgttttggttcatctcact |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43076286 |
acaggcacaggacatgttgcactttttgttcataaaattgttcttttaatattttttgttttggttcatgtcact |
43076212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 33585301 - 33585262
Alignment:
| Q |
18 |
ttaacaaaggcaacaaatcaaggtgtgtgattgggaacta |
57 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
33585301 |
ttaacaaaggcaagaaatcaaggtgtgtgatggggaacta |
33585262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University