View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2722_high_20 (Length: 374)
Name: NF2722_high_20
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2722_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 321; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 357
Target Start/End: Complemental strand, 39231697 - 39231341
Alignment:
| Q |
1 |
ttgagttgtcttttgcatagtcacgtcgagccactgtgattttgataaaaactacattttggaccttcacaaaatcatggtgtcattgcgatttctatga |
100 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
39231697 |
ttgaattgtcttttgtatagtcacgtcgagccaccgtgattttgataaaaactacattttggacctcgacaaaatcatggtgtcatcgcgatttctatga |
39231598 |
T |
 |
| Q |
101 |
tatcatagatgcattatgtggatgaagaagaccctttacaatactgaacactgctctcattcatcctttccaaaacataatgccccatactctcacttgc |
200 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231597 |
tttcatagatgcattaggtggatgaagaagaccctttacaatactgaacactgctctcattcatcctttccaaaacataatgccccatactctcacttgc |
39231498 |
T |
 |
| Q |
201 |
ttccaacaaattctctttacacaaaaactcattcccacaaacttgttcaacttcaccagaaaaatcatgcaaaaacacatgagtctttgggttaccacct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231497 |
ttccaacaaattctctttacacaaaaactcattcccacaaacttgttcaacttcaccagaaaaatcatgcaaaaacacatgagtctttgggttaccacct |
39231398 |
T |
 |
| Q |
301 |
ttcttacttctagccaacaccccggctgtaaatatcgccgacattctcccgggagct |
357 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39231397 |
ttcttacttctagccaacaccccggcggtaaatatcgccgacattctcccgggagct |
39231341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 300 - 358
Target Start/End: Original strand, 33371810 - 33371868
Alignment:
| Q |
300 |
tttcttacttctagccaacaccccggctgtaaatatcgccgacattctcccgggagctg |
358 |
Q |
| |
|
|||||| || ||||||||||| | |||||||| ||||||||||||||||| ||||||| |
|
|
| T |
33371810 |
tttcttgctcctagccaacactgctgctgtaaagatcgccgacattctccccggagctg |
33371868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University