View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2722_high_30 (Length: 300)
Name: NF2722_high_30
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2722_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 17 - 182
Target Start/End: Complemental strand, 10609971 - 10609807
Alignment:
| Q |
17 |
atgagttcccaaataatacagtggacatagttgagtgtgagacacatgtattcaattcagatatgacctcacacattatgacatatactccctcatgttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10609971 |
atgagttcccaaataatacagtggacatagttgagtgtgagacacatgtattcaattcagatatgacctcacacattatgacatatact-cctcatgttt |
10609873 |
T |
 |
| Q |
117 |
ataataaaaccctaccttagcatccacaatggatacacttgctttttggtatttacatagatttca |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10609872 |
ataataaaaccctaccttagcatccacaatggatacacttgctttttggtatttacatagatttca |
10609807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 248 - 285
Target Start/End: Complemental strand, 10609740 - 10609703
Alignment:
| Q |
248 |
cacaaaggtagatttgtcatttaaataatatatattat |
285 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10609740 |
cacaagggtagatttgtcatttaaataatatatattat |
10609703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University