View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2722_high_36 (Length: 276)
Name: NF2722_high_36
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2722_high_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 145 - 261
Target Start/End: Complemental strand, 49119791 - 49119675
Alignment:
| Q |
145 |
atttaattaagtagaaagctaaaaggaattcaaggtagaatttaaaccaatatatgcatttcaacgatcaaaacgaatgaaatattgatatgacaatcac |
244 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||||| |
|
|
| T |
49119791 |
atttaattaagtagaaagctaaatggaattcaaggtagaatttaaaccaatatatgcatttcaaccatcaaaaggaatgaaatattgatacgacaatcac |
49119692 |
T |
|
| Q |
245 |
aatcccgattttttcaa |
261 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
49119691 |
aatcccgattttttcaa |
49119675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 50
Target Start/End: Complemental strand, 49119826 - 49119795
Alignment:
| Q |
19 |
gataaatgtaaagcaaacactaataaaacggt |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49119826 |
gataaatgtaaagcaaacactaataaaacggt |
49119795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University