View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2722_high_45 (Length: 229)
Name: NF2722_high_45
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2722_high_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 210
Target Start/End: Original strand, 44114658 - 44114854
Alignment:
| Q |
14 |
aatatctatctgcatgagcacctgagtagccagagacaccaccatgcaccctcttagcacttagcttcttgttgataggtaggttgaaaatggggtcaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44114658 |
aatatctatctgcatgagcacctgagtagccagagacaccaccatgcaccctcttagcacttagcttcttgttgataggtaggttgaaaatggggtcaac |
44114757 |
T |
|
| Q |
114 |
ttcacaatatgcatcattgatgagttcttggtccacaccatgattaatcacttggaagaaaccatgtttcaaacatgctttcctcacaagctcagca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44114758 |
ttcacaatatgcatcattgatgagttcttggtccacaccatgattaatcacttggaagaaaccatgtttcaaacatgctttcctcacaagctcagca |
44114854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 193
Target Start/End: Complemental strand, 40552813 - 40552768
Alignment:
| Q |
148 |
acaccatgattaatcacttggaagaaaccatgtttcaaacatgctt |
193 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| |||||||| |||| |
|
|
| T |
40552813 |
acaccatgattaatgacttggaaaaaaccatggttcaaacaagctt |
40552768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 40581789 - 40581749
Alignment:
| Q |
148 |
acaccatgattaatcacttggaagaaaccatgtttcaaaca |
188 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
40581789 |
acaccatgattaatgacttggaaaaaaccatggttcaaaca |
40581749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University