View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2722_high_46 (Length: 225)

Name: NF2722_high_46
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2722_high_46
NF2722_high_46
[»] chr4 (1 HSPs)
chr4 (15-212)||(36767046-36767243)


Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 15 - 212
Target Start/End: Complemental strand, 36767243 - 36767046
Alignment:
15 gcataggctttatgatctctgcctaacgcgggacttaagttttttctcgatatctatgttgaacacatgttgaatcatttagtgtttactattaagagga 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||  ||||    
36767243 gcataggctttatgatctctgcctaacgcgggacttaagttttttctcgatatctatgttgaacacatgttggatcatttagtgtttactattagtagga 36767144  T
115 cacacggtgaatatataagaatgtgtttatggtactatctttaacaatttttgtcgtctcaatttttcattgtgctactactaacagatggacaaagt 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
36767143 cacacggtgaatatataagaatgtgtttatggtactatctttaacaatttttgtcgtctcagtttttcattgtgctactactaacagatggacaaagt 36767046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University