View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2722_high_46 (Length: 225)
Name: NF2722_high_46
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2722_high_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 15 - 212
Target Start/End: Complemental strand, 36767243 - 36767046
Alignment:
| Q |
15 |
gcataggctttatgatctctgcctaacgcgggacttaagttttttctcgatatctatgttgaacacatgttgaatcatttagtgtttactattaagagga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
36767243 |
gcataggctttatgatctctgcctaacgcgggacttaagttttttctcgatatctatgttgaacacatgttggatcatttagtgtttactattagtagga |
36767144 |
T |
 |
| Q |
115 |
cacacggtgaatatataagaatgtgtttatggtactatctttaacaatttttgtcgtctcaatttttcattgtgctactactaacagatggacaaagt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36767143 |
cacacggtgaatatataagaatgtgtttatggtactatctttaacaatttttgtcgtctcagtttttcattgtgctactactaacagatggacaaagt |
36767046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University