View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2722_low_27 (Length: 325)
Name: NF2722_low_27
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2722_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 19 - 320
Target Start/End: Original strand, 37710344 - 37710645
Alignment:
| Q |
19 |
tacccgaacaagtgtccacggaggactcctatgagaaaatcgtggtaagcttgccttggatccggtttggatggtccaacttaacttacacactttgatt |
118 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37710344 |
tacccgaacaagtgtcctcagaggactcctatgagaaaatcgtggtaagcttgccttggatccggtttggatggtccaacttaacttacacactttgatt |
37710443 |
T |
 |
| Q |
119 |
aagtggatttagggggagtccatgctatgggccgcgtatgcgttgaagttgagaggtgacccgatccgttgaggttatgggcctcgtcccaatcctgaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
37710444 |
aagtggatttagggggagtccatgctatgggctgcgtatgcgttgaagttgagaggtgacccgatccgttgaggttatgggcctcgtcccagtcttgaac |
37710543 |
T |
 |
| Q |
219 |
aatcaggtttctggtcggatcatttgatctggtaattacgagataatttttgttgagagagtgcacaaattctctttgcaattttgtaggtatattcttg |
318 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
37710544 |
aatcaggtttttggtcggatcatctcatctggtaattacgagagaattgttgttgagagagtgcacaaattctctttgcaattttgtaggtatttttttg |
37710643 |
T |
 |
| Q |
319 |
ga |
320 |
Q |
| |
|
|| |
|
|
| T |
37710644 |
ga |
37710645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 25640596 - 25640641
Alignment:
| Q |
258 |
gagataatttttgttgagagagtgcacaaattctctttgcaatttt |
303 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
25640596 |
gagataatttttgttgtgagaatgcacaaattctctttgcaatttt |
25640641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University