View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2722_low_34 (Length: 292)
Name: NF2722_low_34
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2722_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 16006764 - 16006556
Alignment:
| Q |
1 |
ctaatattggttgattatacattttctgcttacaacatcgtgatggt--ttgaatcatctattttaatttgaaaaatgctaactattgtctttagacact |
98 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16006764 |
ctaatattggttcattatacattttctgattacaacattgtgatggtgtttgaatcatctattttaatttgaaaaatgctaactattgtctttagacact |
16006665 |
T |
 |
| Q |
99 |
agttaagaacataaatatattaaaatatcattttatatggtcagataccataaagatctaaaaat-aaataatcttcaaatcactttgtataatccaatg |
197 |
Q |
| |
|
| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
16006664 |
aattaagaagataaatatattaaaatatcattttgtatggtcagataccataaagatctaaaaataaaatattcttcaaatcactttgtataatccaatg |
16006565 |
T |
 |
| Q |
198 |
tcacaaagg |
206 |
Q |
| |
|
||||||||| |
|
|
| T |
16006564 |
tcacaaagg |
16006556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University