View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2722_low_35 (Length: 288)
Name: NF2722_low_35
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2722_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 36 - 175
Target Start/End: Original strand, 35807797 - 35807936
Alignment:
| Q |
36 |
tggggacgatttggacagggactagtctaaatatactattacttgatgaataaagaataaattttatgaataaattcatatcatcgatcaatttattgaa |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35807797 |
tggggacgatttggacagggactagtctaaatatactattacttgatgaataaagaataaactttatgaataaattcatatcatcgatcaatttattgaa |
35807896 |
T |
|
| Q |
136 |
caaaagattacaaagaattataaaggagagattatataac |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35807897 |
caaaagattacaaagaattataaaggagagattatataac |
35807936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University