View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2722_low_36 (Length: 285)
Name: NF2722_low_36
Description: NF2722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2722_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 52 - 271
Target Start/End: Original strand, 2137732 - 2137951
Alignment:
| Q |
52 |
aatcaaattcataacattttagaaatcataaagtttaacatatctcaccgactgtttggttgagttgatcacagtagcatcggatgactcttgaaacggc |
151 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2137732 |
aatcaaattcataaaattttagaaatcatcaagtttaacatatctcaccgactgtttggttgagttgatcacagtagcatgggatgactcttgaaacggc |
2137831 |
T |
 |
| Q |
152 |
gtgttcccttgctgaagtgtctcaaaggccttcgtaagtcgatctatctcagctaggacttctaagtggttttttgccactgtttcagtgatgcgattca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2137832 |
gtgttcccttgctgaagtgtctcaaaggccttcgtaagtcgatctatctcggctaggacttctaagtggttttttgccactgtttcagtgatgcgattca |
2137931 |
T |
 |
| Q |
252 |
atccagcttctagttctgtg |
271 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2137932 |
atccagcttctagttctgtg |
2137951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 2137669 - 2137701
Alignment:
| Q |
17 |
attttgaactgtaatatgtcttataaattcaat |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2137669 |
attttgaactgtaatatgtcttataaattcaat |
2137701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University